авторефераты диссертаций БЕСПЛАТНАЯ БИБЛИОТЕКА РОССИИ

КОНФЕРЕНЦИИ, КНИГИ, ПОСОБИЯ, НАУЧНЫЕ ИЗДАНИЯ

<< ГЛАВНАЯ
АГРОИНЖЕНЕРИЯ
АСТРОНОМИЯ
БЕЗОПАСНОСТЬ
БИОЛОГИЯ
ЗЕМЛЯ
ИНФОРМАТИКА
ИСКУССТВОВЕДЕНИЕ
ИСТОРИЯ
КУЛЬТУРОЛОГИЯ
МАШИНОСТРОЕНИЕ
МЕДИЦИНА
МЕТАЛЛУРГИЯ
МЕХАНИКА
ПЕДАГОГИКА
ПОЛИТИКА
ПРИБОРОСТРОЕНИЕ
ПРОДОВОЛЬСТВИЕ
ПСИХОЛОГИЯ
РАДИОТЕХНИКА
СЕЛЬСКОЕ ХОЗЯЙСТВО
СОЦИОЛОГИЯ
СТРОИТЕЛЬСТВО
ТЕХНИЧЕСКИЕ НАУКИ
ТРАНСПОРТ
ФАРМАЦЕВТИКА
ФИЗИКА
ФИЗИОЛОГИЯ
ФИЛОЛОГИЯ
ФИЛОСОФИЯ
ХИМИЯ
ЭКОНОМИКА
ЭЛЕКТРОТЕХНИКА
ЭНЕРГЕТИКА
ЮРИСПРУДЕНЦИЯ
ЯЗЫКОЗНАНИЕ
РАЗНОЕ
КОНТАКТЫ


Pages:   || 2 | 3 | 4 | 5 |   ...   | 7 |
-- [ Страница 1 ] --

Материалы конференций

молодых ученых

Россия, Москва, Научно- исследовательский институт вакцин и сывороток им. И.И.

Мечникова Российской академии медицинских наук

, 2008-2013

гг.

УДК 616

ББК 55.1

М34

Научный редактор: Зверев Виталий Васильевич — доктор биологических наук,

профессор, академик РАМН, директор ФГБУ «НИИВС им. И.И. Мечникова» РАМН

М34 Материалы конференций молодых ученых. Россия, Москва, Научно-

исследовательский институт вакцин и сывороток им. И.И. Мечникова Российской академии медицинских наук, 2008-2013 гг. [Электронный ресурс] / под ред. проф. В.В.

Зверева. – Электрон. текст. дан. (1 файл 5,6 Мб). – Киров: МЦНИП, 2013. – 290 с. – 1 электрон. опт. диск (CD-ROM). – ISBN 978-5-906223-84-5. – Загл. с этикетки диска.

В настоящем сборнике представлены материалы 5 конференций молодых ученых НИИВС им.

И.И. Мечникова, проводившихся в период с 2008 по 2013 годы. Основу сборника составили работы участников конференций, отмеченные конкурсной комиссией призовыми местами. В большинстве случаев работы, представленные в настоящем сборнике, являются реализацией идей научных руководителей, опытных наставников, большинство из которых на протяжении многих лет работают в нашем институте. Публикация настоящего сборника является нематериальным выражением понимания необходимости поддержки исследований, проводимых с участием научной молодежи.

ISBN 978-5-906223-84- Статьи публикуются в авторской редакции. Мнение редакции может не совпадать с мнением авторов Перепечатка материалов сборника осуществляется по разрешению редакционной коллегии © ФГБУ "НИИВС им. И.И. Мечникова" РАМН, © МЦНИП, Материалы конференций молодых ученых Россия, г. Москва, НИИВС им. И.И. Мечникова РАМН, 2008-2013 гг.

Содержание Предисловие................................................................................................ Аммур Ю.И., Борисова Т.К., Файзулоев Е.Б., Зверев В.В. Количественное определение вирусов кори, эпидемического паротита и краснухи в вируссодержащих жидкостях на основе ПЦР с детекцией в режиме реального времени..................................................................................... Афанасьева Т.М., Петровских В.П., Мац А.Н. «Стафилолейкин» новый препарат для профилактики и иммунотерапии стафилококковой инфекции.

.................................................................................................. Ахматов Э.А., Курбатова Е.А. Экзосомы дендритных клеток.................. Васильев Ю.М., Каширина О.С., Фролов С.В., Белоусова Р.В., Нагиева Ф.Г. Иммуноадъювантные свойства препарата на основе хитозана при добавлении к вакцинам против болезни Ньюкасла и парагриппа-3..... Черникова М.И., Каширина О.С., Васильев Ю.М. Сравнительное изучение иммуноадъювантов при добавлении к инактивированной вакцине против гриппа............................................................................. Васильев Ю.М., Каширина О.С., Турундаева А.А. Иммуноадъювантные свойства препаратов на основе хитозана с различными физико химическими свойствами при добавлении к инактивированной вакцине против вируса гриппа птиц....................................................................... Воробьев Д.С., Семенова И.Б., Свешников П.Г. Рекомбинантный белок теплового шока индуцирует защиту против бактериальной и вирусной инфекций................................................................................................. Денисова Е.В., Трофимова И.Б., Мац А.Н. Иммуноамплификационная терапия псориаза и псориатической артропатии.................................. Дмитриев Г.В., Борисова Т.К., Файзулоев Е.Б., Зверев В.В. Генетическая характеристика дикого и аттенуированного вариантов штамма С- вируса краснухи....................................................................................... Материалы конференций молодых ученых Россия, г. Москва, НИИВС им. И.И. Мечникова РАМН, 2008-2013 гг.

Дьяков И.Н., Гаврилова М.В., Чернышова И.Н., Сидорова Е.В. Влияние микроокружения на функциональную активность В лимфоцитов мыши.................................................................................................................. Казанова А.С., Боровикова Е.А., Фам Х.Ф., Малышев Н.А., Русанова С.А.2, Кузина Л.Е., Сидоров А.В., Лавров В.Ф., Кузин С.Н. Оценка значимости двойной полимеразной цепной реакции и анализа спонтанной продукции специфичных антител в диагностике инфекции, возникающей вследствие реактивации вируса ветряной оспы и опоясывающего герпеса.......................................................................... Конищева А.Ю., Гервазиева В.Б. Иммунологические параметры аутореактивности при атопической форме бронхиальной астмы........ Максимова Е.Д., Файзулоев Е.Б., Изумрудов В.А., Литманович Е.А., Мелик-Нубаров Н.С. Значение сетчатой структуры катионных наногелей для эффективной трансфекции клеток млекопитающих....................... Файзулоев Е.Б., Оксанич А.С., Ризою С.Ю., Гаврилова Н.Ф., Яковлева И.В., Зверев В.В., Свиридов В.В. Технология рекомбинантных антител.

Сообщение №1: создание продуцента мини-антител к дифтерийному токсину/анатоксину................................................................................. Оксанич А.С., Файзулоев Е.Б., Самарцева Т.Г., Гаврилова Н.Ф., Яковлева И.В., Нагиева Ф.Г., Ризою С.Ю., Зверев В.В., Свиридов В.В. Технология рекомбинантных антител. Сообщение №2: получение химерных антител к дифтерийному токсину/анатоксину....................................... Переверзев А.Д., Маркушин С.Г., Ахматова Н.К., Кривцов Г.Г., Акопова И.И., Коптяева И.Б., Лотте В.Д., Сухно А.С., Борисова О.В., Гендон Ю.З.





Адъювантные свойства производных хитозана на модели инактивированных гриппозных вакцин................................................. Свитич О.А., Ганковская Л.В., Ковальчук Л.В., Лавров В.Ф., Григорьева О.Ю., Лабжинов П.А., Зверев В.В. Изучение роли факторов врожденного иммунитета в защите от инфекции in vitro и in vivo.............................. Солдатенкова А.В., Михайлова Н.А., Свиридов В.В. Перспективы использования моноклональных антител к экзотоксину А Pseudomonas aeruginosa................................................................................................. Материалы конференций молодых ученых Россия, г. Москва, НИИВС им. И.И. Мечникова РАМН, 2008-2013 гг.

Терехов А.В., Кост В.Ю., Цфасман Т.М., Маркушин С.Г. Генетические основы аттенуации холодоадаптированного штамма-донора для живых гриппозных вакцин - А/Краснодар/101/35/59(H2N2)............................ Файзулоев Е.Б., Малахо С.Г., Марова А.А., Оксанич А.С., Щелкунов М.И., Пеков Ю.А., Ашапкин В.В., Суровцев В.В., Зверев В.В. Генетическая характеристика кишечных РНК-содержащих вирусов методами секвенирования нового поколения: подходы к пробоподготовке...... Хоченков Дм.А., Гаврилова М.В., Сидорова Е.В. Роль дендритных клеток в ответе на Т-независимые антигены 2-рода......................................... Материалы конференций молодых ученых Россия, г. Москва, НИИВС им. И.И. Мечникова РАМН, 2008-2013 гг.

ПРЕДИСЛОВИЕ Институт вакцин и сывороток им. И.И. Мечникова основан в 1919 г. и является одним из старейших научных учреждений России. Институт проводит приоритетные исследования как фундаментального, так и прикладного характера. В Институте ведется разработка средств и методов профилактики, диагностики и лечения инфекционных заболеваний. Основной задачей Института всегда была и остается разработка новых медицинских иммунобиологических препаратов. В разное время в Институте были созданы и внедрены в производство и практику здравоохранения более 15 вакцин и других иммунобиологических препаратов. О решающей роли Института в становлении и развитии вакцинно-сывороточного дела в России говорит то, что он имеет прямое или косвенное отношение к разработке большинства отечественных вакцин, применяемых в рамках Национального календаря прививок. В Институте разработано, усовершенствовано и внедрено в практику более 150 препаратов для диагностики вирусных, бактериальных и иммунологических заболеваний.

С момента основания и по сей день в Институте активно проводятся и фундаментальные исследования, направленные на изучение клеточных и молекулярных механизмов врожденного и приобретенного иммунитета при бактериальных и вирусных инфекциях, генетики и молекулярной биологии вирусов, эпидемических закономерностей распространения вирусных инфекций. Таким образом, эффективно осуществляется связь между фундаментальной наукой и практикой, что всегда позволяло Институту быть в числе лидеров среди организаций аналогичного профиля.

В Мечниковском институте работают, учатся в аспирантуре и проходят преддипломную практику более 60 человек, возраст которых не превышает 35 лет. По степени вовлеченности молодых специалистов в научно-исследовательский процесс наш институт занимает одно из ведущих мест в РАМН, а средний возраст сотрудников Института в Материалы конференций молодых ученых Россия, г. Москва, НИИВС им. И.И. Мечникова РАМН, 2008-2013 гг.

году составил 47 лет. Эффективность научно-исследовательской деятельности Института во многом определяется работой молодых ученых института. В Институте работает Совет молодых ученых и проводятся ежегодные конференции молодых ученых. Одновременно с конференциями проводится конкурс на лучшую научную работу, выполненную молодым ученым. В составе конкурсной комиссии, определяющей победителей, работают ведущие специалисты Института в области иммунологии, микробиологии, вирусологии и молекулярной биологии. По сложившейся традиции все участники конференции, представившие результаты своих экспериментальных работ, премируются, а победители поощряются в увеличенном размере.

В настоящем сборнике представлены материалы 5 конференций молодых ученых НИИВС им. И.И. Мечникова, проводившихся в период с 2008 по 2013 годы. Основу сборника составили работы участников конференций, отмеченные конкурсной комиссией призовыми местами. Важно отметить, что, проводя в нашем институте конференции молодых ученых, мы не разделяем науку на «молодую» и «старую» в соответствии с возрастом исполнителя работ, такое разграничение представляется весьма некорректным. Как верно пошутил на эту тему известный советский физик Г.И. Будкер: «Ученые делятся не на молодых и старых, а на умных и дураков». В большинстве случаев работы, представленные в настоящем сборнике, являются реализацией идей научных руководителей, опытных наставников, большинство из которых на протяжении многих лет работают в нашем институте. Поэтому статьи, опубликованные в сборнике, безусловно, в целом отражают уровень исследований, проводившихся в Институте в последние годы.

Мы и в дальнейшем планируем особое внимание уделять привлечению и закреплению в Институте молодых и талантливых специалистов.

Публикация настоящего сборника является нематериальным выражением нашего понимания необходимости поддержки исследований, проводимых с участием научной молодежи.

Директор ФГБУ "НИИВС им. И.И. Мечникова" РАМН, академик РАМН В.В.Зверев Материалы конференций молодых ученых Россия, г. Москва, НИИВС им. И.И. Мечникова РАМН, 2008-2013 гг.

КОЛИЧЕСТВЕННОЕ ОПРЕДЕЛЕНИЕ ВИРУСОВ КОРИ, ЭПИДЕМИЧЕСКОГО ПАРОТИТА И КРАСНУХИ В ВИРУССОДЕРЖАЩИХ ЖИДКОСТЯХ НА ОСНОВЕ ПЦР С ДЕТЕКЦИЕЙ В РЕЖИМЕ РЕАЛЬНОГО ВРЕМЕНИ АММУР Ю.И., БОРИСОВА Т.К., ФАЙЗУЛОЕВ Е.Б., ЗВЕРЕВ В.В.

РОССИЯ, НИИ ВАКЦИН И СЫВОРОТОК ИМЕНИ И.И. МЕЧНИКОВА РАМН Аннотация. В настоящем исследовании были разработаны экспресс-методы определения титра вирусов кори, эпидемического паротита и краснухи (КПК) в вируссодержащих пробах на основе количественной ПЦР с флуоресцентной детекцией в режиме реального времени (ПЦР-РВ). На лабораторных контрольных препаратах было показано, что разработанные методы обеспечивают высокую специфичность, чувствительность, эффективность и воспроизводимость метода. Результаты, полученные методами на основе ПЦР РВ, сравнивали со значениями титров, определенными по ЦПД. Образцы вируссодержащих жидкостей вирусов КПК для анализа получали ежедневно в процессе культивирования этих вирусов на различных клеточных линиях и при различной множественности заражения. Было установлено, что при соблюдении определенных условий разница между величинами титров вирусов КПК в образцах, определенных методом ПЦР-РВ и по ЦПД, находится в пределах допустимой ВОЗ величины (0,5 lgТЦД50/мл). Коэффициент Пирсона между результатами культурального и метода ПЦР-РВ был близок к 1, что свидетельствует о значимой корреляции результатов на определенном временном интервале после инокуляции. Кроме того, было показано, что методы на основе ПЦР-РВ стандартны и менее длительны в сравнении с классическими методами. Таким образом, разработанные методы могут быть использованы как альтернативные или дополнительные к классическим при рутинном определении титра вируса.

Материалы конференций молодых ученых Россия, г. Москва, НИИВС им. И.И. Мечникова РАМН, 2008-2013 гг.

Ключевые слова: ПЦР с детекцией в режиме реального времени, вирус кори, вирус эпидемического паротита, вирус краснухи Введение Титр вируса в вакцинном препарате – одна из важнейших характеристик качества живой вакцины. На стадии производства живых вакцин для определения времени сбора вирусного материала с максимальными титрами оценку специфической активности вирусов кори, эпидемического паротита и краснухи (КПК) традиционно проводят в реакции бляшкообразования (БО) [1-4] или методом предельных разведений по цитопатическому действию (ЦПД) [5-6]. Недостатками этих методов являются их длительность и трудоемкость, сложность в стандартизации и зависимость от внешних факторов [5]. Так, для вирусов эпидемического паротита (ЭП) и краснухи время проведения реакции БО и титрования по ЦПД составляет 8-12 дней. Кроме того, применение этих методов для мультивалентных препаратов вакцин требует дополнительного использования высокоспецифичных антител для каждого компонента вакцины [7]. Таким образом, в настоящее время остается актуальной проблема создания современных методов оценки инфекционного титра вирусов КПК, обеспечивающих высокую специфичность, чувствительность и стандартность проведения реакции.

Одним из показателей интенсивности вирусной репродукции является накопление в культуре клеток вирусных нуклеиновых кислот (НК).

Современные модификации метода полимеразной цепной реакции (ПЦР) позволяют количественно определять НК, в том числе вирусные.

Достоинствами метода ПЦР являются высокая специфичность, чувствительность, универсальность анализа, стандартность проведения реакции и малая длительность процедуры. Метод ПЦР с детекцией в режиме реального времени (ПЦР-РВ) широко используется для количественной оценки вирусных НК в биологических образцах, в том числе зараженных органах и тканях [8]. В то же время, вопрос о том, в каком соотношении в зараженной культуре клеток присутствуют вирусные НК и инфекционный вирус, а также в какой степени накопление НК коррелирует с интенсивностью вирусной репродукции остается Материалы конференций молодых ученых Россия, г. Москва, НИИВС им. И.И. Мечникова РАМН, 2008-2013 гг.

малоизученным. Выяснение этого вопроса позволило бы разработать методические подходы для количественной оценки вируса с помощью метода ПЦР-РВ. В настоящей работе была поставлена цель – разработать методы количественной оценки вирусов кори, эпидемического паротита и краснухи в вируссодержащих жидкостях с помощью ПЦР с флуоресцентной детекцией в режиме реального времени.

Материалы и методы В работе были использованы вакцинные штаммы вируса кори L-16 (титр 5,5-5,7 lg ТЦД50/мл), вируса эпидемического паротита L-3 (титр 5,5-5,7 lg ТЦД50/мл), любезно предоставленные сотрудником ФГБУ «НИИВС им. И.И.

Мечникова» РАМН в.н.с. Ведуновой С.Л., и вируса краснухи Wistar RA 27/ (титр 3,8-4,0 lg ТЦД50/мл, полуфабрикат вакцинного препарата), предоставленный МПБП ФГУП «НПО Микроген» (Россия).

В качестве лабораторных контрольных препаратов были использованы образцы культуральной жидкости, содержащие вирус кори (штамм L-16, титр 6,4 lg ТЦД50/мл), ЭП (штамм L-3, титр 7,1 lg ТЦД50/мл) или краснухи (штамм Wistar RA 27/3, титр 6,3 lg ТЦД50/мл), полученные в культуре клеток Vero.

В качестве контрольных препаратов были использованы: препарат международного стандарта вируса краснухи (1st International Reference Reagent for Rubella (Live), NIBSC Code 91/688, Version 03, Англия) – вакцинный штамм Wistar RA 27/3, полученный в диплоидных клетках человека MRC-5 с титром 103,9инф. ед./мл;

коммерческий препарат (вакцина против краснухи живая аттенуированная) – Rubella Vaccine Live B.P. (R-VACTM, лиофилизированный препарат вакцинного штамма вируса краснухи Wistar RA 27/3, Serum Institute of India;

титр не менее чем ТЦД50/мл).

Перевиваемые культуры клеток Vero (WHO), BHK-21, RK-13 и полуперевиваемая диплоидная клеточная линия MRC-5 были получены из Российской коллекции клеточных культур (Институт цитологии РАН, Санкт Петербург, Россия). Диплоидная клеточная линия М-29 была любезно Материалы конференций молодых ученых Россия, г. Москва, НИИВС им. И.И. Мечникова РАМН, 2008-2013 гг.

предоставлена профессором Л.Л. Мироновой (Институт полиомиелита и вирусных энцефалитов им. М. П. Чумакова РАМН).

Клеточные линии инкубировали в питательной среде MEM (Gibco, США) или RPMI-1640 (Gibco) в присутствии 10% эмбриональной телячьей сыворотки (ЭТС) (HyClone, США), 1 мM глютамина (Gibco) и 50 мкг/мл гентамицина (Gibco) при температуре 37 °C в атмосфере 5 % CO2. При достижении клетками монослоя проводили пересев культуры.

Для заражения клеточного монослоя с различной множественностью заражения клетки инкубировали с разведенным вирусным материалом при 35 °C и 5 % CO2 в течение 30 – 90 мин. После вирусной адсорбции клеточный монослой промывали и культивировали в питательной среде MEM с 2 % ЭТС в течение 7 – 12 суток при 35 °C (для вируса ЭП) или 32 °C (для вирусов кори и краснухи) в атмосфере 5 % CO2. Культуральную жидкость собирали ежедневно с зараженной клеточной культуры, осветляли центрифугированием в центрифуге LMC-3000 (Biosan, США) при 3000 об/мин в течение 10 мин и хранили при -70 °C до использования.

Титрование вирусов КПК методом предельных разведений по ЦПД в чувствительной культуре клеток RK-13 (для вируса краснухи) или Vero (для вирусов кори и ЭП) проводили в 96-луночных планшетах (Greiner Bio-One, Австрия) согласно общей методике [2]. Планшеты инкубировали при 32 °C (для вирусов кори и краснухи) или 35 °C (для вируса ЭП) при 5 % CO2 в течение 10-12 суток. Начиная с 4 – 7-ых суток после заражения, клетки проверяли на наличие цитопатического эффекта и учитывали положительные лунки. При каждом определении титра вируса по ЦПД параллельно исследовали лабораторный контрольный препарат соответствующего вируса с известным титром для контроля калибраторов и воспроизводимости метода. Титр рассчитывали в lg ТЦД50/мл по методу Рида и Менча [6].

Анализ нуклеотидных последовательностей вирусов КПК, полученных из электронной базы данных GenBank (NCBI), подбор последовательностей праймеров и зондов для ПЦР-РВ проводили с помощью компьютерных Материалы конференций молодых ученых Россия, г. Москва, НИИВС им. И.И. Мечникова РАМН, 2008-2013 гг.

программ FastPCR (PrimerDigitalLtd., Финляндия) и Vector NTI Advance 9. (InforMax Inc., США).

Для определения титра вирусов КПК по содержанию вирусной РНК вирусную РНК из образцов и калибраторов выделяли при помощи коммерческого набора «QIAamp Viral RNA Mini Kit» (Qiagen, Германия) согласно инструкции.

При постановке реакции ОТ 2 мкл обратного праймера Rubr, Mef или Muf (табл. 1) в концентрации 5 пмоль/мкл смешивали с 10 мкл соответствующей вирусной РНК и прогревали в течение 5 минут при 65 С в термостате «Термит» (ДНК-технология, Россия). Далее в 30 мкл реакционной смеси, содержащей помимо праймер и РНК, 10-кратный буфер (Синтол, Россия), 0,5 мМ дНТФ (Синтол), 2,5 мМ MgCl2 (Синтол), ед. ингибитора рибонуклеаз (Сибэнзим, Россия), 50 ед. ревертазы вируса лейкоза Молони (MuLV;

Сибэнзим), в течение 30 минут при 42 °C получали кДНК в амплификаторе «Терцик» (ДНК-Технология). Фермент инактивировали нагреванием при 95 °C в течение 5 минут.

Образцы анализировали методом ПЦР-РВ по типу «выщепления 5' концевой метки» (TaqMan®). Амплификацию проводили в 50 мкл реакционной смеси, содержащей 10-кратный буфер, прямой и обратный праймеры (по 10 пмоль каждого), 5 пмоль зонда, 0,5 мМ дНТФ, 2,5 мМ MgCl2, 2,5 ед. HotStart Taq ДНК-полимеразы (Синтол) и 5 мкл кДНК.

Реакцию проводили в термоциклере АНК-32 (Институт аналитического приборостроения РАН, г. Санкт-Петербург, Россия) или ДТ-96 (ДНК технология). Программа ПЦР: 120 сек при 95 °С – 1 цикл, 50 сек при 58 °С и 20 сек при 95 °С – 45 циклов.

Данные представлены в виде М±m, где М – среднее арифметическое, m – стандартное отклонение. Оценку достоверности разницы двух средних показателей проводили с помощью t-критерия Стьюдента.

Корреляционный анализ между титрами одного и того же образца, полученными методом ПЦР-РВ и по ЦПД, проводили с помощью «диаграммы рассеяния» или выборочного линейного парного коэффициента корреляции К. Пирсона.

Материалы конференций молодых ученых Россия, г. Москва, НИИВС им. И.И. Мечникова РАМН, 2008-2013 гг.

Результаты и обсуждение Разработка метода количественного определения вирусов кори, эпидемического паротита и краснухи с помощью ПЦР-РВ.

Подбор праймеров и зондов для выявления вирусов КПК и анализ их специфичности Путем множественного выравнивания всех доступных на момент начала исследования полных геномных последовательностей вакцинных и диких штаммов вирусов КПК были подобраны последовательности праймеров и зонда для каждого вируса, направленных к консервативным участкам геномов для обеспечения их универсальности для различных штаммов вирусов КПК (табл. 1). При компьютерном анализе последовательности сконструированных олигонуклеотидов не образовывали стабильные вторичные структуры в виде шпилек и термодинамически стабильные гомо– и гетеродимеры.

Таблица 1. Олигонуклеотидные последовательности праймеров и зондов, использованных в работе.

Позиция в Вирус Название 5’3’ последовательность геноме Mef AAGGTGGATAAAGTACACCCAA 690- Вирус Mer TGTCACATATCATTTCAGCAAT 856- кори MeV R6G-CCAACCATTTTCTCTCCAATCTAAATTCACC-BHQ1 727- Muf CTGTTCTGCTAGATGAGATGCA 5327- Вирус Mur AGCCTCTCTGCCTCATTGTA 5548- ЭП MuV FAM-TCACACAATCAAATGCATTGGTGATTGAC-BHQ1 5381- Rubf GTCATCACCCACCGTTGT 6435- Вирус Rubr CCTTCTGGAGGTCCTCCAT 6536- краснухи RubV ROX-AGAGCCCCAGGGTGCCCGAAT-BHQ2 6493- ПРИМЕЧАНИЕ. Mef, Muf, Rub1 и Rubf– прямые праймеры, Mer, Mur, Rub2 и Rubr – обратные праймеры, MeV, MuV, RubZ и RubV – зонды.

Специфичность праймеров и зондов была показана электрофоретическим анализом ампликонов и подтверждена ростом сигналов соответствующих флуоресцентных красителей в ПЦР-РВ на РНК-матрицах вакцинных штаммах вирусов кори L-16, ЭП L-3 и краснухи Wistar RA27/3. В результате Материалы конференций молодых ученых Россия, г. Москва, НИИВС им. И.И. Мечникова РАМН, 2008-2013 гг.

амплификации неспецифических ПЦР-продуктов не образовывалось, что подтверждало высокую специфичность праймеров для вирусов КПК.

Оптимизация условий количественного определения вирусов КПК методом ПЦР-РВ С целью достижения максимальной чувствительности теста, условия проведения ПЦР-РВ были оптимизированы эмпирически по концентрации MgCl2, праймеров и зонда в реакционной смеси и температуре отжига.

Были установлены оптимальная температура отжига – 58 °C и концентрация MgCl2 в реакционной смеси – 2,5 мM, использованные в дальнейшей работе.

Влияние концентрации праймеров и зондов оценивали как на этапе ОТ, так и ПЦР, используя 10-кратные и 1000-кратные разведения РНК вирусов КПК. Полученные значения пороговых циклов (Ct) практически не отличались при концентрации праймеров, варьирующей в интервале от 15 до 1,5 пмоль на реакционную смесь на этапах ОТ и ПЦР, снижение концентрации праймеров в пределах данных интервалов практически не влияло на значения Ct. В качестве рабочей концентрации праймеров была выбрана концентрация 10 пмоль каждого праймера на 50 мкл реакционной смеси для этапа ПЦР и 10 пмоль на реакционную смесь на этапе ОТ.

Построение калибровочных кривых Калибровочные образцы были приготовлены путём последовательных разведений лабораторных контрольных препаратов вирусов КПК (титры 6,4 lg ТЦД50/мл, 7,1 lg ТЦД50/мл и 6,3 lg ТЦД50/мл, соответственно). Титр калибровочных образцов определяли титрованием по ЦПД в 3-х или более повторах для каждого вируса, а также подтверждали при каждом титровании по ЦПД.

По амплификационной кривой, для построения которой одновременно с исследуемыми образцами анализировали калибровочные образцы вирусов КПК в двух или трех повторах, значение Ct для каждого образца измерялось автоматически с помощью программного обеспечения к Материалы конференций молодых ученых Россия, г. Москва, НИИВС им. И.И. Мечникова РАМН, 2008-2013 гг.

прибору АНК-32 или ДТ-96. На основании амплификационных кривых строили калибровочную кривую (рис. 1), позволяющую с учетом значений Ct, отложенных по оси абсцисс, определить титр вируса по содержанию РНК по оси ординат. Результат количественной ПЦР-РВ высчитывали по отношению к калибровочному образцу с титром, выраженным в lgТЦД50/мл, и, вследствие этого, также выражали в lgТЦД50/мл.

Рис. 1 (A, B, C). Оценка чувствительности метода путем ПЦР-РВ-анализа серийных разведений контрольных образцов вирусов КПК. Калибровочная кривая для вируса кори (А), ЭП (В), краснухи (С). Результаты регрессионного анализа (коэффициент детерминации R2 и тангенс угла наклона а) показаны в верхнем правом углу графика.

Чувствительность, линейность и эффективность метода ПЦР-РВ для оценки титра вирусов кори, эпидемического паротита и краснухи Чувствительность метода была определена в трех повторах при исследовании 10-кратных серийных разведений РНК, выделенной из образцов вирусов КПК, с титрами вирусов, варьирующими от 1,5x105 до 1,5x100 (для вируса кори) от 1,2x107 до 1,2x100 (для вируса ЭП) и от 2,0x Материалы конференций молодых ученых Россия, г. Москва, НИИВС им. И.И. Мечникова РАМН, 2008-2013 гг.

до 2,0x100 (для вируса краснухи) ТЦД50/мл. Аналитическая чувствительность составила менее чем 15, 120 и 20 ТЦД50/мл для вирусов КПК, соответственно. По полученным данным были построены кривые нанесением значений Ct, относительно известного значения титра контрольных образцов вирусов КПК (рис. 1).

Коэффициент детерминации (R2) калибровочных кривых для вирусов КПК был близок к 1 (рис. 1), указывая на точное log-линейное отношение между концентрацией РНК для каждого вируса и значением Ct, что, в свою очередь, указывает на постоянное значение эффективности для реакций ОТ в пределах изучаемых интервалов для вирусов КПК [9].

Кривые описываются общим линейным уравнением, где коэффициент а выражает тангенс угла наклона калибровочных кривых (Рис. 1) и позволяет оценить эффективность ПЦР в 1,84, 1,94 и 1,97 для вирусов КПК, соответственно.

Чувствительность выявления кДНК вируса краснухи в реакции ПЦР была определена при исследовании 10-кратных серийных разведений плазмиды со встроенным фрагментом генома вируса краснухи (модель кДНК) и составила 1500 копий/мл с воспроизводимостью 100 % или копий/мл с воспроизводимостью 25 %. Для разведения плазмиды со встроенным фрагментом генома вируса краснухи по полученным данным реакции ПЦР также была построена кривая (Y = 48,082 - 3,456*X), R которой был близок к 1 (R2 = 0,99). Тангенс угла наклона кривой (-3,456) позволяет оценить эффективность ПЦР в 1,94, что соответствует эффективности ПЦР, определенной на разведениях образца вирусной РНК, выделенного из лабораторного контрольного препарата вируса краснухи.

Таким образом, в реакции ОТ и ПЦР-РВ путем анализа серийных разведений лабораторных контрольных штаммов вирусов КПК была показана высокая чувствительность, линейность и эффективность ПЦР-РВ в выбранных условиях и с подобранными праймерами.

Материалы конференций молодых ученых Россия, г. Москва, НИИВС им. И.И. Мечникова РАМН, 2008-2013 гг.

Воспроизводимость метода количественного определения вирусов кори, эпидемического паротита и краснухи на основе ПЦР-РВ Каждая постановка реакции ПЦР-РВ проводилась c калибровочными образцами c известным титром для построения калибровочной кривой.

Калибровочные кривые были воспроизводимы, сохраняя схожие значения R2 и тангенсы углов наклона для всех трех вирусов.

Межэкспериментальный коэффициент вариации значений Ct был получен на основе результатов более 20 индивидуальных реакций для каждого из калибраторов и составил 4,2 %, 3,5 % и 6,6 % для вирусов КПК, соответственно.

Внутриэкспериментальный коэффициент вариации значений Ct (или дисперсии метода), выражающий изменчивость значений Ct от пробирки к пробирке, составил 1,6 %, 3,1 % и 0,9 % для вирусов КПК, соответственно.

Для определения коэффициента вариации для результатов, получаемых методом количественного определения вирусов КПК на основе ПЦР-РВ, были проанализированы 5 образцов вирусов КПК в 3-х независимых экспериментах. Коэффициент межэкспериментальной вариации метода составил для вирусов кори 6,3%, ЭП 4,7% и краснухи 7,8%, что указывает на удовлетворительную воспроизводимость метода.

Апробация разработанного на основе ПЦР-РВ метода на контрольных вакцинных препаратах Для апробации разработанного метода количественной оценки вируса на основе ПЦР-РВ провели оценку титра вируса краснухи штамма Wistar RA 27/3 в эталонных препаратах – международном вакцинном стандарте и коммерческом препарате – вакцине против краснухи, методом ПЦР-РВ в четырех повторах и по ЦПД в трех повторах (табл. 2). ВОЗ принята рекомендация о возможности применения метода оценки титра вируса, если разница между величинами определенного титра не превышает 0, lg ТЦД50/мл [WHO/VSQ/97.04].

Таким образом, было показано, что разница между величиной титра вируса краснухи в международном стандарте и вакцинном препарате, Материалы конференций молодых ученых Россия, г. Москва, НИИВС им. И.И. Мечникова РАМН, 2008-2013 гг.

определенная методом ПЦР-РВ и по ЦПД, находится в пределах 0,2 lg ТЦД50/мл, что укладывается в допустимые ВОЗ пределы.

Таблица 2. Сравнение титров вируса краснухи в контрольных вирусных препаратах.

Титр по реакции ЦПД, Титр по ПЦР-РВ, Эталонные препараты lg ТЦД50/мл lg ТЦД50/мл Препарат международного стандарта 4,0 + 0,2 4,05 + 0, вируса краснухи (3,9 lg ТЦД50/мл) Вакцина против краснухи (Serum Institute 4,75 + 0,09 4,81 + 0, of India) (4,5-4,8 lg ТЦД50/мл) Оценка корреляции результатов определения титра вирусов кори, эпидемического паротита и краснухи методом на основе ПЦР-РВ и по ЦПД.

При разработке и апробации нового метода важно сравнить результаты, полученные этим методом и классическими методами, принятыми в качестве «золотых стандартов» для данного вируса, и провести корреляционный анализ [10]. С этой целью клетки Vero заражали вирусом краснухи (штамм Wistar RA 27/3, титр 3,8-4,0 lg ТЦД50/мл) с множественностью 0,1 инфекционная единица на клетку и ежедневно отслеживали динамику накопления вируса по накоплению вирусной РНК методом ПЦР-РВ и титрованием по ЦПД. На основании полученных двумя методами данных были построены кривые роста вируса краснухи в культуре клеток Vero (рис. 2А).

Материалы конференций молодых ученых Россия, г. Москва, НИИВС им. И.И. Мечникова РАМН, 2008-2013 гг.

Рис. 2 (А, В, С). Кривые накопления вирусов краснухи (штамм Wistar RA 27/3) (А), кори (В) и ЭП (С) в культуральной жидкости, собранной с зараженной культуры клеток Vero, построенные по результатам методов ПЦР-РВ () и ЦПД () (множественность заражения 0,1 инф. ед./кл.). Здесь и на последующих рисунках каждая точка представляет среднее 3-х (по ЦПД) или 6-ти (методом ПЦР-РВ) значений, полученных в 3-х независимых экспериментах на каждый метод, отрезки прямой погрешности представляют значения стандартного отклонения от среднего для каждой точки.

Со 2-ых по 7-ые сутки после заражения культуры клеток Vero вирусом краснухи значения титров вируса, определенные методом ПЦР-РВ и по ЦПД, близки и разница в величинах не превышает 0,5 lgТЦД50/мл, что свидетельствует о хорошем совпадении результатов для данного временного интервала (рис. 2А). При расчете коэффициента корреляции между значениями титра вируса краснухи по ЦПД и ПЦР-РВ также было выявлено хорошее совпадение результатов: коэффициент корреляции Материалы конференций молодых ученых Россия, г. Москва, НИИВС им. И.И. Мечникова РАМН, 2008-2013 гг.

Пирсона для временного интервала со 2-ых по 7-ые сутки был близок к (r2=0,98). На ранних и более поздних сроках культивирования (до 2-ого дня и после 7-ого дня) отмечена достоверная разница значений титров.

Аналогичным образом были собраны и исследованы по ЦПД и методом ПЦР-РВ образцы супернатантов с культуры клеток Vero, зараженных вирусом кори (штамм L-16, титр 5,5-5,7 lg ТЦД50/мл) и ЭП (штамм L-3, титр 5,5-5,7 lg ТЦД50/мл) с множественностью 0,1 инфекционная единица на клетку (рис. 2В, С).

Для временного интервала с 3-их по 6-ые сутки после заражения была установлена значимая корреляция результатов значений титров, определенных по ЦПД и методом ПЦР-РВ, с коэффициентом корреляции Пирсона близким к 1 (r2=0,99 для вируса кори и r2=0,96 для вируса ЭП) (рис. 2В, С). Расхождения между результатами на 2-ые и после 6-ых суток репликации вирусов кори и ЭП были значимы.

Расхождение значений титров вирусов КПК после 6-7-ых суток культивирования вследствие снижения инфекционного титра и повышения концентрации вирусной РНК в исследуемом материале может быть связано с постепенным разрушением вирионов и зараженных клеток, сопровождающимся выходом в культуральную жидкость репликативных форм вирусного генома или РНП не полностью собранных вирионов, а также аккумуляции дефектных интерферирующих геномов [11]. Расхождение в титрах вируса, определенных методом ПЦР-РВ и по ЦПД до 2-3-его дня культивирования, объясняются, по всей видимости, определением в ПЦР-РВ РНК дефектных вирионов, не вошедших в клетки при заражении.

В целом значения титров вирусов КПК, определенные методом ПЦР-РВ, были выше сравнительно со значениями, полученными по ЦПД, что согласуется с более ранними результатами количественных исследований для вируса желтой лихорадки [12], вируса гриппа [13] и вируса лихорадки долины Рифт [14], полученными также в ПЦР-РВ и классическими методами. Однако анализ Пирсона выявил значимую корреляцию между значениями титров, определенных двумя методами. Более того, для Материалы конференций молодых ученых Россия, г. Москва, НИИВС им. И.И. Мечникова РАМН, 2008-2013 гг.

определенного временного интервала после инокуляции разница в титрах, определенных двумя методами для вирусов КПК, не превышали значение, допустимое ВОЗ (0,5 lgТЦД50/мл).

Зависимость корреляции значений титров, полученных методом на основе ПЦР-РВ и по ЦПД, от клеточного субстрата Культуры клеток Vero, ВНК-21, MRC-5 или М-29 в состоянии полного монослоя заражали вирусом краснухи (штамм Wistar RA 27/3, титр 3,8-4, lg ТЦД50/мл) с множественностью заражения 0,1 инф.ед./клетку и в разные сроки культивирования отбирали образцы культуральной жидкости для определения титра вируса. Оценку титра вируса краснухи проводили по ЦПД и методом ПЦР-РВ, по полученным данным были построены кривые накопления вируса краснухи (рис. 2А, 3).

Динамика накопления вируса краснухи в культуральной жидкости во всех культурах клеток несколько отличалась по абсолютным величинам, но общая схема была однотипной (рис. 2А, 3). Максимальных значений титр вируса при данной дозе заражения достигал на 6-7-е сутки культивирования. Наибольшие значения титра вируса по ЦПД были получены в культуре клеток ВНК на 6-е сутки культивирования: 6,3 – 6,5 lg ТЦД50/мл.

Для культур клеток Vero, MRC-5 и М-29 показано, что со 2-ого (для Vero, рис. 2А) и 4-ого (для MRC-5, М-29, рис. 3) по 7 день после заражения клеток вирусом краснухи значения титров вируса, определенные методом ПЦР-РВ и по ЦПД, близки и разница в величинах не превышает 0, lgТЦД50/мл, а рассчитанный коэффициент корреляции Пирсона для данного временного интервала близок к 1. Это свидетельствует о хорошем совпадении результатов для выбранного временного отрезка.

Корреляция результатов титров, полученных двумя методами в культуре клеток ВНК-21, гораздо менее значима. Однако до 7-ого дня после заражения отмечается схожий характер поведения кривых роста вируса, построенных по результатам ЦПД и ПЦР-РВ – кривые идут параллельно и разница в значениях составляет 0,5-0,75 lgТЦД50/мл (рис. 3). Как известно, Материалы конференций молодых ученых Россия, г. Москва, НИИВС им. И.И. Мечникова РАМН, 2008-2013 гг.

для определенного вируса соотношение неинфекционных и инфекционных вирусных частиц может варьировать в зависимости от клеточной линии. Таким образом, разница, наблюдаемая на рисунке для культуры клеток ВНК-21, вероятно, является следствием того, что вирус краснухи образует больше дефектных вирионов на этой клеточной культуре, чем на культуре клеток Vero, используемой для получения калибровочного материала.

7, 6, 5, Титр, lgТЦД50/мл 4, BHK- 3,5 (qPCR RT) 3 BHK- (CCID50) 2, 2 3 4 5 6 День после заражения Рис. 3. Динамика накопления вируса краснухи по результатам, полученным методом ПЦР-РВ и по ЦПД, при его культивировании в культурах клеток ВНК-21, MRC-5 и M- (множественность заражения 0,1 инф. ед./кл.).

Таким образом, установлено, что метод оценки титра вируса краснухи в вируссодержащей жидкости с помощью ПЦР-РВ обеспечивает высокую корреляцию результатов с культуральным методом для культур клеток Vero, MRC-5 и М-29 при исследовании образцов, полученных в определенном временном интервале после заражения.

Аналогично, для вируса кори и ЭП было проведено сравнение кинетики накопления вируса в культурах клеток Vero и М-29 методом ЦПД и ПЦР РВ. С 3-их по 6-ые сутки для обеих культур наблюдалась хорошая корреляция результатов титров вирусов, полученных по ЦПД и методом Материалы конференций молодых ученых Россия, г. Москва, НИИВС им. И.И. Мечникова РАМН, 2008-2013 гг.

ПЦР-РВ, а разница в величинах не превышала 0,5 lgТЦД50/мл. Для культуры клеток Vero коэффициент корреляции Пирсона (R2) составил 0,92, для культуры клеток М-29 – 0,99.

Влияние множественности заражения культуры клеток вирусами кори, эпидемического паротита и краснухи на корреляцию значений титров, полученных методом ПЦР-РВ и по ЦПД Разработанный на основе ПЦР-РВ метод количественной оценки вируса был апробирован в экспериментах с различной множественностью заражения вирусами КПК культуры клеток Vero: 1,0, 0,1 и 0, инфекционные единицы на клетку (Рис. 4). В качестве примера на рисунке 4 приведены кривые накопления вируса краснухи в культуральной жидкости при множественности заражения 1,0 (А), 0,01 (В) и 0,001 (С) инф.

ед./клетку.

А В С Рис. 4. Кривые накопления вируса краснухи в культуральной жидкости, собранной с зараженной культуры клеток Vero при множественности заражения 1,0 (А), 0,01 (В) и 0,001 (С) инф. ед./клетку, построенные по результатам методов ПЦР-РВ () и ЦПД ().

Наилучшее совпадение результатов определения титров вирусов КПК методами ПЦР-РВ и ЦПД наблюдалось при дозах заражения 0,1 и менее инф. ед./клетку (Рис. 4В, С). Коэффициенты корреляции были близки к 1.

При использовании более высокой множественности заражения (1 инф.

ед./клетку) величины титров, определенные двумя методами, отличались в пределах 0,5 – 0,75 lg ТЦД50/мл (Рис. 4А). Как видно из рисунка 4А кривые титров при данной множественности заражения идут параллельно. В этом случае при расчете титра вируса краснухи в Материалы конференций молодых ученых Россия, г. Москва, НИИВС им. И.И. Мечникова РАМН, 2008-2013 гг.

вируссодержащей жидкости, определенного с помощью метода ПЦР-РВ, следует вводить поправочный коэффициент.

При анализе вирусного материала методом, основанным на количественной ПЦР-РВ, РНК как инфекционных, так и неинфекционных вирионов одинаково количественно учитывается. Следовательно, ПЦР-РВ может использоваться для оценки вирусного титра только при соблюдении определенных условий, позволяющих снизить долю неинфекционных вирионов и свободного РНП в препарате, таких как:

заражение клеток дозой, не превышающей 0,1 инф. ед./клетку;

получение вирусного материала для оценки титра вируса во временном диапазоне со 2-ого по 7 день после заражения для вируса краснухи или с 3-его по день после заражения для вирусов кори и ЭП;

использование калибровочных образцов, полученных в тех же условиях и с той же культуры клеток, что и вирусный материал;

осветление образца низкоскоростным центрифугированием на стадии пробоподготовки;

хранение вирусных образцов при определенных условиях, препятствующих потере их инфекционности;

при необходимости введение поправочного коэффициента при расчете титра вируса;

использование системы выделения РНК, рекомендованной для количественных тестов для достижения максимальной точности и чувствительности метода. Несмотря на то, что, метод ПЦР-РВ не может полностью заменить традиционные методы контроля специфической активности, он может быть использован в процессе производства вакцин для определения времени сбора вирусного материала.

Заключение В настоящем исследовании на основе ПЦР-РВ с детекцией в режиме реального времени разработаны новые методические подходы для оценки титра вирусов КПК в вакцинных препаратах. Показана высокая степень корреляции между значениями титров вирусов КПК, получаемых методом на основе ПЦР-РВ, с результатами титрования по ЦПД соответствующих вирусов. Установлены факторы, влияющие на точность определения титра вирусов КПК методом ПЦР-РВ: тип клеточной линии, Материалы конференций молодых ученых Россия, г. Москва, НИИВС им. И.И. Мечникова РАМН, 2008-2013 гг.

используемой для получения исследуемого и калибровочного материала, множественность инфекции, условия пробоподготовки, сроки взятия образца для исследования после заражения. При апробации метода на культурах клеток Vero, BHK-21, MRC-5, M-29 установлено, что точность определения титра вирусов КПК методом на основе ПЦР-РВ зависит от типа клеточной линии, используемой для получения исследуемого и калибровочного материала. При апробации метода в экспериментах с различной множественностью заражения клеточного монослоя показана обратная зависимость между множественностью инфекции и точностью определения титра вирусов КПК методом на основе ПЦР-РВ.

На основе ПЦР-РВ разработаны методы определения титров вирусов КПК в культуральных образцах. Разработанные методы обеспечивают высокую специфичность, чувствительность, стандартность проведения реакции и, что немаловажно, меньшую длительность проведения процедуры (5- часов работы) в сравнении с классическими методами. Разработанные методы способны повысить эффективность контроля качества вирусного материала, а также могут быть использованы при производстве вакцинных препаратов для определения времени сбора вирусного материала в процессе приготовления вакцин.

Список литературы:

1. Desiatskova, R.G., Andzhaparidze O.G. Plaques formed by rubella virus in cell culture under agar cover. Vopr. Virusol. 1968;

13: 283-286.

2. Fogel, A., Plotkin, S.A. Markers of Rubella Virus Strains in RK-13 cell Culture. J.Virology.

1969;

3: 157-163.

3. Frothingham, T. E., Granoff, A. Plaque formation with mumps virus. Virology. 1961;

15:

213-214.

4. Underwood, G.E. Studies on measles virus in tissue culture. I. Growth rates in various cells and development of a plaque assay. J. Immunol. 1959;

83: 198-205.

5. Forcic, D., Kosutic-Gulija, T., Santak, M., Jug, R., Ivancic-Jelecki, J., Markusic, M., Mazuran, R. Comparison of mumps virus potency estimates obtained by 50% cell culture infective dose assay and plaque assay. Vaccine. 2010;

28: 1887-1892.

6. Reed, L.J., Muench, H. A simple method of estimating fifty percent endpoints. Am. J.

Hygiene. 1938;

27: 493–497.

7. Ranheim, T., Mathis, P.K., Joelsson, D.B., Smith, M.E., Campbell, K.M., Lucas, G., Barmat, S., Melissen, E., Benz, R., Lewis, J.A., Chen, J., Schofield, T., Sitrin, R.D., Hennessey, Jr.J.P.

Материалы конференций молодых ученых Россия, г. Москва, НИИВС им. И.И. Мечникова РАМН, 2008-2013 гг.

Development and application of a quantitative RT-PCR potency assay for a pentavalent rotavirus vaccine (RotaTeq®). J. Virol. Methods. 2006;

131: 193-201.

8. Niesters, H.G.M. Quantitation of viral load using real-time amplification techniques.

Methods. 2001;

25: 419-429.

9. Freeman, W.M., Walker, S.J., Vrana, K.E. Quantitative RT-PCR: pitfalls and potential.

Biotechniques. 1999;

26: 112-125.

10. Klein, D. Quantification using real-time PCR technology: applications and limitations.

Trends Mol. Med. 2002;

8: 257-60.

11. Calain, P., Roux, L. Generation of Measles Virus Defective Interfering Particles and Their Presence in a Preparation of Attenuated Live-Virus Vaccine. J. Virol. 1988;

62: 2859 2866.

12. Bae, H.-G., Nitsche, A., Teichmann, A., Biel, S.S., Niedrig, M. Detection of yellow fever virus: a comparison of quantitative real-time PCR and plaques assay. J. Virol. Methods 2003;

110: 185-191.

13. Youil, R., Sua, Q., Toner, T.J., Szymkowiak, C., Kwan, W-S., Rubin, B., Petrukhin, L., Kiseleva, I., Shaw, A.R., DiStefano, D. Comparative study of influenza virus replication in Vero and MDCK cell lines. J. Virol. Methods. 2004;

120: 23-31.

14. Garcia, S., Crance, J., Billecocq, A., Peinnequin, A., Jouan, A., Bouloy, M., Garin, D.

Quantitative real-time PCR detection of rift valley fever virus and its application to evaluation of antiviral compounds. J. Clin. Microbiol. 2001;

39: 4456-4461.

Материалы конференций молодых ученых Россия, г. Москва, НИИВС им. И.И. Мечникова РАМН, 2008-2013 гг.

«СТАФИЛОЛЕЙКИН» НОВЫЙ ПРЕПАРАТ ДЛЯ ПРОФИЛАКТИКИ И ИММУНОТЕРАПИИ СТАФИЛОКОККОВОЙ ИНФЕКЦИИ АФАНАСЬЕВА Т.М., 1ПЕТРОВСКИХ В.П., 2МАЦ А.Н.

РОССИЯ, НПО «МИКРОГЕН» МЗ РФ, «ПЕРМСКОЕ НПО «БИОМЕД»

РОССИЯ, НИИ ВАКЦИН И СЫВОРОТОК ИМЕНИ И.И. МЕЧНИКОВА РАМН Аннотация. В совместных исследованиях Пермского НПО «Биомед» и ФГБУ НИИВС им. Мечникова РАМН из плазмы доноров, вакцинированных стафилококковым анатоксином, были выделены ранее неизвестные иммунопептиды с молекулярной массой 5 – 8 кДа, представляющие собой фрагменты растворимых антигенсвязывающих белков Т-клеточного происхождения, которые можно отнести к серологическим коррелятам протективного антистафилококкого иммунитета. Эти иммунопептиды обладают уникальным иммунобиологическим свойством – специфически связываясь с иммобилизованным стафилококковым анатоксином, они повышают функциональную аффинность связывания гомологичных антител с тем же антигеном. Разработана технология экспериментального производства антистафилококковых иммунопептидов (препарат «Стафилолейкин») в фармацевтически приемлемой лекарственной форме для инъекций. В доклинических испытаниях установлено, что «Стафилолейкин» не обладает ни острой, ни хронической токсичностью, защищает мышей от подострого стафилококкового менингоэнцефалита, способствует излечению стафилококкового кератита у кроликов, индуцирует у мышей гиперчувствительность замедленного типа к стафилококковому белку А, определяемую в реакции конгломерации лейкоцитов и по отёку лапки.

Предполагается, что «Стафилолейкин» можно будет использовать в качестве специфического иммуноадъюванта при вакцинопрофилактике и иммунотерапии стафилококковой инфекции.

Материалы конференций молодых ученых Россия, г. Москва, НИИВС им. И.И. Мечникова РАМН, 2008-2013 гг.

Ключевые слова: Растворимые Т-клеточные антигенспецифичные иммунопротеины. Трансфер-факторные иммунопептиды. Низкомолекулярные антигенспецифичные цитокины. Антистафилококковый иммунитет.

Противостафилококковая иммунотерапия.

Введение Начиная с 70-х годов XX века, известно о существовании в лейкоцитарных экстрактах, плазме крови и молозиве человека низкомолекулярных иммунопептидов, способных переносить специфический клеточный иммунитет иммунизированного донора неиммунному реципиенту и обладающих терапевтическим потенциалом при недостаточности противоинфекционного иммунитета [3, 4, 6, 10]. Более трёх тысяч публикаций посвящено клинической эффективности препаратов, приготовленных на основе этих иммунопептидов, но вполне определённое позитивное суждение Кокрановского сотрудничества было опубликовано впервые только в 2012 г. по результатам мета-анализа клинических испытаний. Препараты иммунопептидов (по старой терминологии, «трансфер-фактора») были достоверно эффективны как средство профилактики и лечения нозокомиальной (чаще всего, стафилококковой) инфекции у детей с нефротическим синдромом.

Отмечен значимый позитивный эффект иммунотерапии без серьёзных побочных реакций [15].

Предполагаемую природу и функцию этих иммунопептидов выражает их современное название – «низкомолекулярные антигенспецифичные цитокины» (НАСЦ) [9], которое, по нашему мнению, следует дополнить термином «и хемокины», поскольку ряд хемокинов связывается с компонентами микробов [16]. К 2000 г. выяснено, что они образуются в ходе адаптивного иммунного ответа, имеют Т-клеточное происхождение и молекулярную массу около 5 кДа и, подобно антителам, аффинно связываются с гомологичными антигенами. Установлено также, что иммунопептиды, очищенные до гомогенности аффинной сорбцией на иммобилизованных антигенах различной специфичности, представляют собой гидрофильные одноцепочечные -глобулины, имеющие Материалы конференций молодых ученых Россия, г. Москва, НИИВС им. И.И. Мечникова РАМН, 2008-2013 гг.


вариабельную и константную части. Последняя у мышей образована десятью аминокислотными остатками L L Y A Q D L/V E D N на С-конце [10].

В настоящее время на фармацевтическом рынке существует пять фармакопейных препаратов c доказанной иммунотерапевтической эффективностью. Это – «Аффинолейкин» (Россия), «Immodin» (Чехия), «Leukonorm» (Германия), «Hebertrans» (Куба) и «Transfern» (Мексика).

Производство всех пяти аналогов однотипно и начинается cо взятия крови у нормальных (неиммунизированных предварительно) доноров. Из крови выделяют лейкоциты, их разрушают, готовят экстракт, из которого диализом или ультрафильтрацией получают компоненты с молекулярной массой менее 10 кДа.

Так как указанные иммунопептиды содержатся и в плазме крови, представлялось целесообразным разработать технологию их выделения непосредственно из плазмы крови доноров, предварительно вакцинированных против стафилококковой инфекции. В отечественной технологии производства иммуноглобулина по Кону (дифференциальное этаноловое осаждение при минусовой температуре) сами иммунопептиды и их предшественники содержатся во фракции, обозначаемой как «осадок Б». Именно он использован нами в качестве сырья для выделения иммунопептидов, поскольку как отход производства не имеет технологических и экономических ограничений использования, свойственных донорской крови или лейкоцитарной массе.

Цель работы. Исследование промежуточных и конечного продуктов экспериментальной технологии производства нового антистафилококкового препарата на основе антигенспецифичных цитокинов/хемокинов из отхода производства антистафилококкового иммуноглобулина.

Материалы и методы.

НАСЦ, входящие в состав «Стафилолейкина», выделяли «из осадка Б»

(фракция III по Кону). Содержащие этанол осадки собирали с поверхности ротора суперцентрифуги при температуре минус 20С в ходе Материалы конференций молодых ученых Россия, г. Москва, НИИВС им. И.И. Мечникова РАМН, 2008-2013 гг.

приготовления 10 серий антистафилококкового иммуноглобулина. Из «осадка Б» сначала по методу R. Cone et al. (2002) [8] переосаждением сульфатом аммония выделяли растворимые Т-клеточные антигенсвязывающие белки (ТАБ), которые затем разрушали до протомеров многократным замораживанием-оттаиванием (криодезагрегацией) в диссоциирующем насыщенном CO2 растворе с этилендиаминотетраацетатом натрия, мочевиной и цистеином. Для выделения НАСЦ после криодезинтеграции применяли последовательную дифференциальную диафильтрацию на мембранных модулях с ретенцией 30, 10 и 5 кДа (Sartorius, Германия). Далее препарат стерилизовали мембранной микрофильтрацией, стабилизировали глицином (0,54%), подвергали пастеризации при 60о C в течение 10 час., ампулировали и лиофилизировали.

Для определения молекулярных параметров использовали ВЭЖХ на колонке Superdex 2000 10/300 [Элюция 0,15 М раствором хлорида натрия, забуференным (pH 7,12) 0,05 M фосфатами калия, со скоростью 0, мл/мин.] и ДСН-ПААГЭ по H. Schgger [14].

Влияние готового препарата НАСЦ («Стафилолейкина») на аффинность связывания стафилококковых антител со стафилококковым анатоксином исследовали в иммуноферментном анализе (ИФА). На полистироловых панелях адсорбировали анатоксин 0,8 мкг/мл (0,34 ЕС/мл). В качестве антитоксина использовали разведения коммерческого антистафилококкового иммуноглобулина человека (100 мг/мл).

Связавшиеся с анатоксином антитоксин выявляли конъюгатом стафилококкового белка А (СБА) с пероксидазой хрена или биотинированными антителами кролика к иммуноглобулину человека.

ИФА связывания антитоксина с анатоксином проводили в двух вариантах нанесения реагентов. Вариант 1: анатоксин + «Стафилолейкин» + антитоксин Ig + конъюгат. Вариант 2: анатоксин + антитоксин Ig + «Стафилолейкин» + конъюгат.

Иммуноспецифическую активность «Стафилолейкина» исследовали в четырёх тестах.

Материалы конференций молодых ученых Россия, г. Москва, НИИВС им. И.И. Мечникова РАМН, 2008-2013 гг.

(1) Перенос гиперчувствительности замедленного типа (ГЗТ), регистрируемый по кожным пробам с СБА, адсорбированным на алюмокалиевых квасцах, был воспроизведён на мышах BALB/c, самцах весом 23 – 25 г по методике Brummer E. et al., модифицированной нами [2]. «Стафилолейкин» вводили интраплантарно в четыре лапки, в объёме 50 мкл. Предварительно оттитрованная оптимальная доза составила мкг на мышь. За сутки до постановки кожной пробы на боковой поверхности туловища мыши выстригали шерсть и наносили крем для эпиляции. При постановке пробы внутрикожно вводили 13 мкг СБА (Pharmacia-LKB, Швеция), адсорбированного на алюмокалиевых квасцах, в объёме 10 мкл. Кожные реакции (положительной считали папулу диаметром не менее 4 мм) учитывали через 24 и 48 ч.

(2) Перенос ГЗТ, регистрируемый в реакции СБА-зависимой конгломерации лейкоцитов мышей после введения «Стафилолейкина».

Активность «Стафилолейкина» выражалась величиной дозы в мкг, введение которой мышам в 100 раз снижает пороговую концентрацию СБА, вызывающую конгломерацию циркулирующих лейкоцитов, в сравнении с эффектом введения неспецифического иммуностимулятора – натрия нуклеината. 12 мышей F1 (СВА С57ВL/6J) или F1 (С57ВL/6J СВА) (одного пола, массой тела 22 – 25 г) распределяли на 4 группы (по мыши) и вводили в основание хвоста подкожно по 0,2 мл следующие растворы: 1-я группа (контроль) – 20 мкг натрия нуклеината (Sigma, США);

2-я группа – 4 мкг;

3-я группа – 20 мкг и 4-я группа – 100 мкг «Стафилолейкина». Через сутки мышей вскрывали под эфирным наркозом и у каждой брали по 0,8 мл крови в 0,2 мл 6,1% раствора натрия цитрата трёхзамещённого 5,5-водного. Затем готовили серии разведений СБА в полистиролловом «планшете для иммунологических реакций» с круглодонными лунками и во все лунки вносили по 100 мкл 6,1% раствора натрия цитрата. После этого «рабочий» раствор, содержащий 25,6 мкг СБА в 1 мл, вносили по 100 мкл в лунки «Н» с 1 по 6 ряд планшета. Затем, перемешав на шейкере содержимое лунок, последовательными переносами 100 мкл раствора из лунки в лунку от «Н» до «В», то есть, готовили серии двукратных разведений СБА: 6,4 – 3,2 – 1,6 – 0,8 – 0,4 – 0, Материалы конференций молодых ученых Россия, г. Москва, НИИВС им. И.И. Мечникова РАМН, 2008-2013 гг.

– 0,1 мкг/мл. После этого в лунки «Н» с 7 по 12 ряд вносили по 50 мкл рабочего раствора СБА и, перемешав последовательными переносами мкл раствора из лунки в лунку от «Н» до «В», готовили серии трехкратных разведений СБА: 4,3 – 1,4 – 0,5 – 0,16 – 0,05 – 0,018 – 0,006 мкг/мл. Лунки «А» с 1 по 12 ряд содержали только 100 мкл 6,1% раствора натрия цитрата и представляли собой «контрольные» для каждого ряда.

В приготовленный планшет во все лунки одного ряда от «Н» до «А»

вносили по 100 мкл стабилизированной цитратом крови от одной мыши.

Планшет сверху герметизировали пленкой «Парафилм М» (Sigma, США), и помещали в термостат при температуре (38,0 ± 1,0)°С на 3 часа. Каждый час планшет извлекали из термостата, помещали на 3 мин на шейкер, добиваясь перемешивания содержимого лунок, и вновь помещали в термостат.

На горизонтальной поверхности раскладывали 96 чистых обезжиренных предметных стекол. По окончании инкубации из каждой лунки, начиная с «А», перемешав, дважды переносили по 50 мкл крови на маркированное предметное стекло и распределяли ее по поверхности наконечником пипетки в виде двух одинаковых «толстых капель» диаметром около 2 см.

Мазки оставляли на воздухе до полного высыхания.

Высушенные мазки, не фиксируя, осторожно погружали в 0,01% раствор метиленового голубого на 10 минут. После гемолиза и окрашивания «толстых капель» мазки осторожно извлекали из красителя и, не промывая и не касаясь капель, вновь высушивали на воздухе.

Для просветления на поверхность мазка наносили иммерсионное масло и исследовали под микроскопом при 80-кратном увеличении. Обе капли каждого мазка просматривали по продольному диаметру, начиная с лунки «А». В последовательно сменяющихся полях зрения обращали внимание на взаимное расположение лейкоцитов и, встретив клеточные агломераты, определяли число образовавших их лейкоцитов. Учитывали любые агломераты, состоящие только из сегментоядерных или только из мононуклеарных лейкоцитов, а также смешанного состава, глобулярной и цепочечной формы. Просматривая обе капли каждого мазка, выявляли Материалы конференций молодых ученых Россия, г. Москва, НИИВС им. И.И. Мечникова РАМН, 2008-2013 гг.

три наиболее крупных агломерата и усредненное число образующих их клеток заносили в таблицу, соответствующую расположению лунок на планшете. Просматривая далее мазки из лунок от «В» до «Н», находили ту лунку данного ряда, 3 самых крупных агломерата которой содержат в среднем на 2 и более лейкоцитов больше, чем усредненная численность максимальных агломератов в мазках из лунки «А». Концентрацию СБА в этой лунке принимали за пороговую (ПК), вызвавшую конгломерацию (укрупнение агломератов) лейкоцитов данной мыши.

После этого вычисляли среднюю геометрическую пороговых концентраций (СПК) СБА в каждой группе животных, извлекая кубичный корень из произведений ПК каждой из мышей. Затем, последовательно разделив СПК первой (контрольной) группы животных на СПК второй, третьей и четвертой групп, вычисляли «индексы переноса» (И) для каждой из введенных доз (Д) «Стафилолейкина», то есть, И1 для 4 мкг, И2 для мкг и И3 для 100 мкг. Затем находили сумму И (И = И1 + И2 + И3 ) и сумму произведений ИД (ИД = И14 + И220 + И3 100), а после этого – дозу препарата, которая дает «индекс переноса» равный 100, по формуле линейной регрессии:

(И Д) 260 1,7 И ( мкг).

Д 1,2 (И Д) - И (3) Перенос антистафилококковой резистентности на модели подострого менингоэнцефалита у мышей, заражённых интрацеребрально S. aureus MT-1 [5].


«Стафилолейкин» вводили мышам CBA/Sto (самцы, весом 22 – 24 г) итраплантарно в четыре лапки в дозе 32 мкг и в разные сроки после этого заражали животных в мозг S. aureus MT-1, вводя 20 – 100 LD50. Гибель мышей учитывали в течение месяца.

(4) Оценка потенциала «Стафилолейкина» в экспериментальной терапии язвенных поражений роговицы стафилококковой этиологии у кроликов.

Модель стафилококкового стромального гнойного кератита воспроизвели на 10 кроликах, породы «Шиншилла» самцах весом 2,5 – 3,0 кг. Под Материалы конференций молодых ученых Россия, г. Москва, НИИВС им. И.И. Мечникова РАМН, 2008-2013 гг.

местной анестезией скальпелем с алмазным лезвием делали надрез роговицы. Затем микрохирургическим шпателем, расслаивая строму, создавали полость, в которую вводили 0,1 мл взвеси S.aureus МТ-1 ( ед/мл по стандарту мутности). Ежедневно оценивали по баллам гиперемию конъюнктивы век, перикорнеальную инъекцию сосудов, смешанную инъекцию и инфильтрацию роговицы. Инстилляции «Стафилолейкина» (по 2 капли, содержащие 10 мкг, в конъюнктивальный мешок обоих глаз 4 раза в день) начинали через 1 сутки после заражения, когда развивалась выраженная одинаковая в опытной (5 кроликов) и контрольной (5 кроликов) группе картина воспаления с образованием стромального инфильтрата роговицы. В контрольной группе инстиллировали 0,9% раствор натрия хлорида.

Результаты.

Разработана полупроизводственная технология получения препарата НАСЦ («Стафилолейкина») из отхода производства противостафилококкового иммуноглобулина, сочетающая фракционирование донорской плазмы крови этанолом при минусовой температуре, выделение из «осадка Б» фракции, содержащей ТАБ, и конечные стадии получения коммерческого препарата «Аффинолейкин»

[1].

На рис. 1 представлена хроматограмма полуфабриката после многократного замораживания-оттаивания (криодезинтеграции). Расчёт по площадям и наложение хроматограммы калибрантов свидетельствуют о том, что он содержит 67 % пептидов с молекулярной массой около от до 17 кДа. Эти белки очищали далее путём дифференциальной диафильтрации на мембранных модулях с ретенцией 30, 10 и 5 кДа. На хроматограмме рис. 2 готовый препарат «Стафилолейкин» гомогенен и даёт один пик иммунопептидов молекулярной массы от 5 – 8 кДа. Те же результаты определения молекулярной массы получены при Трицин-ДСН ПААГЭ по H. Schgger в 16%-м геле (рис. 3).

Материалы конференций молодых ученых Россия, г. Москва, НИИВС им. И.И. Мечникова РАМН, 2008-2013 гг.

39.1 mV ch мин 2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40 42 44 Рис. 1. ВЭЖХ полуфабриката «Стафилолейкина» после криодезинтеграции ТАБ.

Колонка Superdex 2000 10/300. Элюция 0,15 М раствором хлорида натрия, забуференным (pH 7, 12) 0,05 M фосфатами калия, со скоростью 0,5 мл/мин. Детекция при 280 нм.

16.1 mV ch мин 2 4 6 8 10 12 14 16 18 20 22 24 26 28 30 32 34 36 38 40 42 44 46 48 50 52 54 Рис. 2. ВЭЖХ конечного препарата «Стафилолейкин», полученного из криодезинтеграта ТАБ последовательной дифференциальной диафильтрацией на мембранных модулях с ретенцией 30, 10 и 5 кДа фирмы Sartorius (Германия). Условия хроматографии, как указано в подписи к рис. 1.

В ИФА «Стафилолейкин» специфически повышал функциональную аффинность стафилококкового антитоксина лишь при одном условии, когда его наносили на иммобилизованный анатоксин до наслоения антител. Это сдвигало конечную точку титрования на 2 – 3 лунки к концу ряда (рис. 4). В то же время наслоение «Стафилолейкина» после антитоксина перед наслоением антииммуноглобулинового конъюгата не влияло на результаты титрования.

Материалы конференций молодых ученых Россия, г. Москва, НИИВС им. И.И. Мечникова РАМН, 2008-2013 гг.

Рис. 3. Трицин-ДСН-ПААГЭ по H. Schgger в 16% геле [14] (1) Калибранты с отметкой молекулярной массы в кДа;

(2) Бычий инсулин 5,7 кДа;

(3 и 4) Готовый препарат «Стафилолейкин»;

Гель окрашен Кумасси ярко-голубым.

Разность оптической плотности между лунками при первом и втором варианте титрования характеризовала увеличение аффинности антител под влиянием «Стафилолейкина» и зависела от концентрации этих двух реагентов. На графике рис. 5 вершинами парабол наблюдаемой зависимости отмечены их оптимальные концентрации: 3 – 25 мкг/мл антител и 0,15 – 0,25 мкг/мл «Стафилолейкина».

1, 0, 0, 0, 0, 0 5 10 15 20 25 30 Концентрация Антитоксина Ig, мкг/мл Рис. 4. Увеличение связывания стафилококкового антитоксина с иммобилизованным анатоксином после наслоения «Стафилолейкина». По оси ординат оптическая плотность раствора хромогена в ИФА. Верхняя кривая – первый вариант нанесения реагентов: анатоксин + «Стафилолейкин» + антитоксин Ig + конъюгат, нижняя – второй вариант: анатоксин + антитоксин Ig + «Стафилолейкин» + конъюгат.

Материалы конференций молодых ученых Россия, г. Москва, НИИВС им. И.И. Мечникова РАМН, 2008-2013 гг.

0, 0, 0,2-0, 0,15-0, 0, 0,1-0, Разность ОП 0, 0,05-0, 0-0, 0, 0, 25 Концентрация 4, 3 8, Концентрация антитоксина Ig, 1,5 «Стафилолейкина»

0, мкг/мл мкг/мл Рис. 5. Разность ОП между первым вариантом нанесения реагентов: анатоксин + «Стафилолейкин» + антитоксин Ig + конъюгат, и вторым вариантом: анатоксин + антитоксин Ig + «Стафилолейкин» + конъюгат, характеризует увеличение аффинности антистафилококковых антител, оптимально проявляющееся при 3 – 25 мкг/мл антител и 0,15 – 0,25 мкг/мл «Стафилолейкина».

Усиление аффинности связывания антистафилококковых антител с иммобилизованным анатоксином под влиянием «Стафилолейкина»

проявлялось только в специфичной системе «стафилококковый анатоксин – антитоксин», но не при взаимодействии антигена и антител другой специфичности, то есть, связывание «Стафилолейкина» с иммобилизованным анатоксином увеличивало его комплементарность в отношении антител по типу дополнительного слабоаффинного пептид белкового взаимодействия. По-видимому, данный специфический шапероноподобный эффект «Стафилолейкина» лежит в основе его иммуноадъювантного и иммунокорригирующего действия in vivo, как показано ниже.

При переносе ГЗТ, регистрируемый по кожным пробам с СБА, в трёх группах по 20 мышей, которым ввели «Стафилолейкин», положительная кожная реакция отмечена у 12, 15 и 16 животных. Отличие от контрольных мышей, которым в лапки ввели 0,9% раствор хлорида натрия, было значимым при p 0, 025 (критерий Фишера). СБА, подобно туберкулину, – классический антиген, к которому формируется иммунологическая память у человека. В то же время он – поверхностный соматический антиген Материалы конференций молодых ученых Россия, г. Москва, НИИВС им. И.И. Мечникова РАМН, 2008-2013 гг.

большинства вирулентных штаммов S. aureus, вызывающий иммунный ответ у каждого индивида с ненарушенным иммунологическим статусом.

Колонизация стафилококком кожи и слизистых оболочек начинается вскоре после рождения, и эта латентная инфекция рассматривается как причина появления специфичных к СБА иммунопептидов, выявляемых в данном исследовании в образцах «Стафилолейкина».

При переносе ГЗТ, регистрируемый в реакции СБА-зависимой конгломерации лейкоцитов мышей, доза «Стафилолейкина», дающая «индекс переноса», равный 100 (Д100), не превышала 50 мкг/мышь.

Медиана и 95% доверительный интервал по Ван дер Вардену Д образцов десяти серий «Стафилолейкина» составили 6 (4 32) мкг/мышь.

Введение «Стафилолейкина» за неделю до интрацеребрально заражения S. aureus MT-1 защищало в разных опытах от 20 до 25% животных (отличие от контроля было незначимо). Однако инъекция Стафилолейкина за день до заражения защищало в трёх опытах 30 – 60% мышей. В двух опытах со «Стафилолейкином» выжили 55 и 60% мышей (p 0,025;

критерий Фишера). Наибольшую протективную активность (70 – 80% выживших мышей, p 0,01;

критерий Фишера) проявлял «Стафилолейкин» при введении в мозг в одном шприце с заражающей дозой.

На модели стафилококкового стромального гнойного кератита у кроликов через трое суток лечения, была отмечена заметная (значимая по баллам) разница тяжести воспалительного процесса в опытной и контрольной группе животных. К концу недели в половине глаз опытной группы признаки воспаления исчезли, тогда как в контрольной у всех животных имел место воспалительный процесс. На девятые сутки в глазах опытной группы воспалительный процесс был завершен, а в контрольной у всех животных отмечались его слабо выраженные признаки. Через две недели в опытной группе образовались легкие помутнения со слабо заметными новообразованными сосудами. В контрольной – отмечались грубые помутнения с выраженными новообразованными сосудами, что свидетельствовало о большей тяжести прошедшего воспалительного Материалы конференций молодых ученых Россия, г. Москва, НИИВС им. И.И. Мечникова РАМН, 2008-2013 гг.

процесса. Таким образом, инстилляции «Стафилолейкина» в конъюнктивальный мешок на неделю, по сравнению с контролем, ускоряли заживление при значимом различии балльных оценок.

Согласно данным доклинических исследований на мышах и морских свинках «Стафилолейкин» не обладал ни острой, ни хронической токсичностью, был апирогенен и не вызывал активации миелопоэза и воспалительной реакции в месте подкожного введения.

Обсуждение Marchalonis J. J. et al. (1982) [12] выделили из обработанных бромцианом Т-клеточных мембран приматов белковый фрагмент с молекулярной массой 12 кДа, напоминающий Fd-фрагмент IgG, отметив структурное и функциональное сходство этого белка с «трансфер-фактором» Lawrence H.

S. [6, 10]. Эта находка положила начало изучению ТАБ. Выяснилось, что они функционируют как факторы антигенспецифичной иммуноcупрессии при хронических инфекциях, инвазиях, а также при онкопатологии и аутоаллергии [7, 8, 11]. Сначала основным направлением практического приложения этого открытия было иммунодиагностическое выявление ТАБ при ВИЧ-инфекции, малярии, слоновой болезни, кандидамикозе, меланоме, а также при аллергии к белкам молока и органическим растворителям [8, 11]. Но, кроме того, в 1991 г., по данным экспериментов на животных была сформулирована идея препарата ТАБ для терапии аутоиммунных заболеваний, которая, однако, не была реализована на практике, по-видимому, из-за реактогенности входящих в его состав высокомолекулярных (боле 600 кДа) белков [13].

Разработанный нами новый иммунопрофилактический и терапевтический препарат «Стафилолейкин» представляет собой, не сами ТАБ, а их низкомолекулярные фрагменты, утратившие иммуносупрессивные свойства и обладающие высокой пенетрантностью в тканях.

Фармакодинамика и фармакокинетика «Стафилолейкина» позволяет надеяться на его широкое клиническое применение [3].

Материалы конференций молодых ученых Россия, г. Москва, НИИВС им. И.И. Мечникова РАМН, 2008-2013 гг.

Cтафилококки периодически заселяют кожу и слизистые оболочки верхних и нижних дыхательных путей не менее 70% населения. Они формируют биоплёнки и нередко переходят от бессимптомного комменсализма к внутриклеточной резиденции и антибиотикорезистентной инфекции, создающей серьёзные клинические проблемы в хирургии, пневмологии, оторинолярингологии и дерматологии. Поскольку несмотря на многочисленные попытки в мире пока не создано эффективной стафилококковой вакцины, новый препарат для профилактики и терапии стафилококковой инфекции крайне необходимым.

Заключение.

Разработана оригинальная технология получения препарата низкомолекулярных цитокинов/хемокинов из отходов серийного производства антистафилококкового иммуноглобулина. Биологичекая схема: Осадок Б (III фракция по Кону) ТАБ – НАСЦ –«Стафилолейкин», воспроизводима в лабораторных и производственных условиях. При накоплении замороженных запасов «осадка Б» и наличии спроса разработанная технология может быть масштабирована.

Список литературы:

1. Афанасьева Т.М., Петровских В.П., Николаева А.М., Казьянин А.В., Мац А.Н.

Технология получения препарата «Стафилолейкин» из осадка «Б» отхода производства антистафилококкового донорского иммуноглобулина.// Вестник биотехнологии 2013. – Т. 8, № 1. – С. 27 – 31.

2. Бухвальд З., Перепечкина Н.П., Салов В.Ф., Мац А.Н. Местный специфический иммунный ответ на белок А Staphylococcus aureus в лимфоидной ткани миндалин человека.// – Ж. микробиол. эпидемиол. иммунобиол., 1985. – № 5.

– С. 78 – 83.

3. Мац А.Н. «Трансфер-фактор» – это N-концевая часть «протомера» растворимого Т-клеточного антигенсвязывающего белка. //Аллергология и иммунология 2005.

– Т. 6, № 2. – С. 140 – 143.

4. Мац А.Н., Боков М.Н., Кузьмина М.Н. Концепция низкомолекулярных антигенспецифичных цитокинов и её новые практические приложения // Аллергология и иммунология. – 2008. – Т. 9, № 4. – С. 444 –447.

5. Мац А.Н., Перелыгина О.В., Хромачёва Р.П., Перепечкина Н.П., Табачник А.Л.

Штамм Staphylococcus aureus MT-1, используемый для оценки протективной Материалы конференций молодых ученых Россия, г. Москва, НИИВС им. И.И. Мечникова РАМН, 2008-2013 гг.

активности имунологических и химиотерапевтических противостафилококковых препаратов.// Авторское. Свидетельство СССР № 1103556, 1984.

6. Borkowsky W, Lawrence HS. Deletion of antigen-specific activity from leukocyte dialysates containing transfer factor by antigen-coated polystyrene.// J Immunol.

1981 – Vol. 126, No. 2. – P. 486 – 489.

7. Cone RE. Molecular basis for T lymphocyte recognition of antigens.// Prog Allergy.

1981 – Vol. 29. – P. 182 – 221.

8. Cone R.E., Georgiou G.M., Little C.H. Soluble T-lymphocyte antigen-specific immunoproteins: a progress report. // Exp Biol Med (Maywood), 2002. – V. 227, N 7. – P.438 –444.

9. Dumonde DC, Kirkpatrick CH, Pizza G. Eleventh International Congress on Transfer Factors: March 1-4, - 1999, Monterrey, Nuevo Leon, Mexico. // J. Interferon Cytokine Res., 2000. – V. 20, N 4. – P.439–441.

10. Kirkpatrick C.H. Transfer factors: identification of conserved sequences in transfer factor molecules // Mol. Med. – 2000. – Vol. 6. – Р. 332–341.

11. Kosonen J., Rantala A., Little C.H., Lintu P., Harjamki P.R., Georgiou G.M., Cone R.E., Savolainen J. Increased levels of Candida albicans mannan-specific T-cell-derived antigen binding molecules in patients with invasive candidiasis.// Clin Vaccine Immunol. 2006. – Vol. 13, No. 4. – P. 467 – 474.

12. Marchalonis J.J., Hunt J.C., Maxwell J., Wang A.C. Antigenic polypeptide fragments of a receptor related to the Fab fragment of human immunoglobulin from thymus derived lymphocytes.// Proc Natl Acad Sci USA, 1982 – Vol. 79, No. 15 – P. 4733 – 4736.

13. Trentham D.R. (Beth Israel Hospital Association) Treathment of autoimmune Diseases.// Patent WO/1991/015236, 1991.

14. Schgger H. Tricine-SDS-PAGE.//Nat Protoc. 2006 – Vol. 1, No. 1, – P. 16 – 22.

15. Wu H.M., Tang J.L., Cao L., Sha Z.H., Li Y. Interventions for preventing infection in nephrotic syndrome // Cochrane Database Syst. Rev. – 2012. – 4:CD003964. doi:

10.1002/14651858.CD003964.pub3.

16. Yung S.C., Parenti D., Murphy P.M. Host chemokines bind to Staphylococcus aureus and stimulate protein A release. J Biol Chem. 2011. – Vol. 286, No.7. – P. 5069 – 5077.

Материалы конференций молодых ученых Россия, г. Москва, НИИВС им. И.И. Мечникова РАМН, 2008-2013 гг.

ЭКЗОСОМЫ ДЕНДРИТНЫХ КЛЕТОК АХМАТОВ Э.А., КУРБАТОВА Е.А.

РОССИЯ, НИИ ВАКЦИН И СЫВОРОТОК ИМ. И.И. МЕЧНИКОВА РАМН Аннотация. Экзосомы мембранные везикулы эндоцитозного происхождения диаметром 40-100 нм, которые высвобождаются множеством типов клеток путем присоединения мультивезикулярных телец к плазматической мембране, что, по-видимому, служит транспортным средством для межклеточной коммуникации. Изучены функциональные особенности и протективная активность экзосом – дериватов дендритных клеток (ДК), генерированных из костного мозга мышей. Экзосомы, полученные из ДК, как и сами ДК, нагруженные антигенами вируса гриппа, обладали высокой функциональной активностью. Экзосомы стимулировали продукцию провоспалительных (TNF, IL-6, IL-1) и регуляторных цитокинов (INF, IL-12). Активация врожденных механизмов защиты и представление вирус-специфических антигенов (H5N2) в составе экзосом Т-лимфоцитам приводила к формированию адаптивного иммунитета – возникновению стойкой антиген-специфической защиты от вируса гриппа у мышей.

Ключевые слова: экзосомы, цитокины, дендритные клетки Введение Экзосомы мембранные везикулы эндоцитозного происхождения диаметром 40-100 нм, которые высвобождаются множеством типов клеток путем присоединения мультивезикулярных телец к плазматической мембране, что, по-видимому, служит транспортным средством для межклеточной коммуникации. Протеомная каталогизация экзосом разнообразных типов клеток выявила единый набор мембранных и цитозольных белков, что может свидетельствовать об эволюционной важности этих мембранных частиц. К тому же экзосомы экспрессируют множество белков, имеющих отношение к клеткам организма, а также содержат инактивированные формы mRNA и microRNA, которые могут быть переданы другой клетке и быть функционально активными в новом Материалы конференций молодых ученых Россия, г. Москва, НИИВС им. И.И. Мечникова РАМН, 2008-2013 гг.

окружении. Способность экзосом поставлять нуклеиновые кислоты к отдалённым клеткам сделала их идеальными кандидатами для генотерапии [1]. Экзосомы секретируются множеством клеточных типов в нормальных и патологических условиях: гемопоэтическими (ретикулоциты, тромбоциты, B и T лимфоциты, тучные клетки, дендритные клетки) и негемопоэтическими клетками (эпителиальные клетки, фибробласты). Интенсивное высвобождение экзосом опухолевыми клетками и повышение их уровня в крови в течение поздней стадии заболевания, а также сверхэкспрессия определенных биомаркеров опухолевых клеток свидетельствуют о важной роли экзосом в диагностике и исследовании биомаркеров [2]. Экзосомы в организме выполняют разнообразные функции: регуляция иммунного ответа [3,4];

представление антигена [5];

передача РНК и белков [6];

передача инфекционных частиц (например, вирусы и прионы) [7];

взаимодействие/передача сигналов от клеток к клеткам [2]. Экзосомы играют важную роль при инфекционных процессах. В частности, была показана способность вирусов накапливаться во внутриклеточных микровезикулах и было обнаружено высвобождение вирусных маркеров на экзосомах. Вполне вероятно, что экзосомы, являясь контейнерами для переноса вирусов, могут участвовать в инфицировании интактных клеток.

Экзосомы, секретируемые инфицированными клетками, поглощаются незараженными макрофагами и могут модулировать иммуннный ответ, вызывая его стимуляцию или супрессию [8]. Принимались попытки использования экзосом в качестве вакцин против различных патогенных микроорганизмов. Установлено, что данные микровезикулы, высвобождаемые клетками, зараженными внутриклеточными патогенными микроорганизмами, такими как Mycobacterium tuberculosis, содержали микробные компоненты и такие экзосомы обладали иммуномодулирующей активностью [9].

Цель работы: изучить функциональные особенности и протективную активность экзосом – дериватов дендритных клеток, генерированных из костного мозга мышей.

Материалы конференций молодых ученых Россия, г. Москва, НИИВС им. И.И. Мечникова РАМН, 2008-2013 гг.

Материалы и методы Препараты. В качестве индукторов созревания ДК использовали коммерческий TNF- (20 нг/мл, Biosours, США), поликомпонентную вакцину из антигенов условно патогенных микроорганизмов Иммуновак-ВП-4® (25 мкг/мл) и комплекс антигенов вируса гриппа H5N (по 25 мкл/мл, ФГБУ «НИИ вакцин и сывороток им. И.И. Мечникова»

РАМН). Штамм вируса гриппа птиц H5N2 (A/Mallard/Pеnsil/1024/84 H5N2), выделенный от уток и адаптированный к мышам (штамм предоставлен Ю.А.Смирновым ФГБУ «НИИ вирусологии им. Д.И.

Ивановского" РАМН).



Pages:   || 2 | 3 | 4 | 5 |   ...   | 7 |
 



Похожие работы:





 
© 2013 www.libed.ru - «Бесплатная библиотека научно-практических конференций»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.